EST 1200359 is a singleton


Sequence

>1200359 (1 EST) Length=453 AATAATTCTGGACAATCTTTTTATTATTATTTATAATTTCTAGTAATGAATTAAACAAATTTTCATGATAAACTCTCGAC ATCCACATGCTTTTAAATATAAGTGATATTTCATTTTTTCTAAAAGGAGTGTTTCTAATAATTCGATAAAATAAATCACT ATATAATTCTCCTATAATAAAAATATTTATATTTGTGTTAATATTAAAAAAAATCATATCTATTATTTGACTACATGTCA GTAATTCTAATTTTATATTATATTTATATAAACCACTATTTGAAGCAGCAAAATAAGAAACATCACTATTGTTGGTATAA TACTCATAACAATTAATTGGTGATGAAATATTATCGTCTTTTATTACACAATTATAATTATGTTCAACCATTTTATTTTT ATGATCACCATGTATATTAACCACATCTATGTTACCGTCACCATTTTTTTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200359: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003592320601AA5503491491m3gmbPfHB3.1, G. Roman Reddy


Date: 12:36:25 on Fri 17 Nov 117.