EST 1200362 is a singleton


Sequence

>1200362 (1 EST) Length=281 TTTATTTATTTATTTATATTTTTATATTTATTTATTTTAATTTTAGGATATGTGGACAACTTGATTATGCGACCAGCGGT CTTCTTATTGTAGCCAAAGATAAGCTAAGCTGCAATATTTTAAATTACAATATAGAGAGTAAAAATATAAGTAAAATATA TTTGGCTATATTATATGGTCATCTACCATTAGATATCCTTCATATAAATACACCTATAAGTAAAAACAAGGAAGGATTTA AAATGAANCTTTGTTATAATTATAATGATTATTATGACAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200362: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003622320604AA5503521495m3gmbPfHB3.1, G. Roman Reddy


Date: 11:9:44 on Sun 19 Nov 117.