EST 1200371 is a singleton


Sequence

>1200371 (1 EST) Length=497 TTACATTATAATAACTCCGTTATGTTCATTGGCATTTCATCAATTTGTGTTGAATAATACTGTTCGATGTCCCTAAGAAT TTTTATATCATCATTTTTAACAAAATTAATAGCTACTCCTTTTCTTCCAAACCTTCCACTCCTACCAATTCTATGAATAT AACTTTCTCTTGAATTAGGCAAATCATAATTAACAACAAGTGACACTTCTTGTACATCTAAACCTCTTCCCCATATATCT GTAGATATTAATACACGAAATTTACATTGCCTAAATTTCAACATGATATCATCTCTTTCACTTTGACTCATTCCTGCATG CATTTTACACACAGTAAAATTCGATTCTAACATCTTTTTGGTTAACCAATCCACTTTCATCTGTGTATTACAAAAAACTA CTGCTTGTGTTATTGTTAAACTTTCATATAAATCTGCTAAGGTCTCATATTTCCATTGCTCTTTTTCTATAGATACGAAA AATTGCTTAATTCCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200371: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003712320613AA5503611506m3gmbPfHB3.1, G. Roman Reddy


Date: 13:27:21 on Fri 24 Nov 117.