EST 1200373 is a singleton


Sequence

>1200373 (1 EST) Length=641 TAAATATAAATGATTATATTATTTTGTGAAATCATCTTGAATAAGCTATTTCTTTTAACTGTGGTGGAACAGTTTGATTT GTTTTATTTAACAATTTAATTAACTCTTTTGCAAACTTTAATTTTTGTGGCATATAATAATCATACGAAAAGAACAAGAT TGATTTCCCTTTTTTCCCAGCTCTTCCTGTTCTTCCTATTCTATGTATATAATCTTCTATAGTATTAGGTATATCATAAT TAATGACAACAGAAATATTTTTAATATCTAATCCTCTTGAAGCTACATCGGTTGCTACTAATATATTACATCGATCTGTT TTGTAATTATTCAATATTCGATCTCTTTCTCTTTGCTGCTTATCCCCATGAATTGATAAAGCATTATACTGATGATATCT TAATTCTTTACATAAATTATCACAATTTCTTTTGGTATCACAAAATATTAATATTTTATTATTTTCATAATTTTCTTTTA ACCAATCTAATAATTTTTTCTTCATATCAATAGAAGAACTTATAATAACATTTTGCTCAATATTTTTATTTGCTGTCAAT TCATTTTTTCCTATTTGAATTTTTACTGGATCATAGGAACAAAAATCATATGCAAGTTTCCTGACTTGTTCAGGCCATGT A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200373: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003732320615AA5503631508m3gmbPfHB3.1, G. Roman Reddy


Date: 23:8:19 on Fri 24 Nov 117.