EST 1200374 is a singleton


Sequence

>1200374 (1 EST) Length=361 ATTCATATCTTTACCATTATGAATAGACCACATACATCGATCAGTGATGATAATATGGTTGTACTACAACAAGAAGATGA AAAAATCGATAAACAAAAAGACATAGACAAAAAGGAGGACAAGAAAAATATGTCAACAAATAGAAAGGAATATAAGAAAA AGAAAAAGAAATATATTATTTCCAACAAAATATTGAAGCATATAGATAATATAGACAAATTAAAATACGTGGGAATTAAT CGTATTGATGAAAAACAAAAAAAAAGTTATTTGGAAAATATACCAGGGGGGAGGATTAAAAAGCTAAATAAACAAATAAA TGATAATAAAGATGAAAGAAAGAAAAAGAGAACAAATATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200374: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003742320616AA5503641509m3gmbPfHB3.1, G. Roman Reddy


Date: 6:55:4 on Sat 25 Nov 117.