EST 1200377 is a singleton


Sequence

>1200377 (1 EST) Length=489 TATTTTTTTTATTTTACATATTTTAAATATTTTCAAATATGTTTAAAATGCATTTATATAATTTGTTACATTTATTCTTA TGAATCGAACATATCTCTGAATCTTCATGATGGTCATTATTTTTATTATCATTTTCTTGGTCATATGTATTATTTATAAT TTGATTCTCTCCCTTCCTTTTGGTATCCTCTACATTGATAGTATTCTCTTCTATGATACTGTTACAATCACTATTATTTT CTGTATTACTATCTCCAGATTTGTTAGAAACACTAAATATATCTATATCTACATATTCCTTACTTTTATAATTCTCTTTT ATTTTGTCTTTATCAAATCCTCTTTGTTTTTTTATCCAGCTGGATATTTTTGCCATATATATTTGTGAAAATATTAAAAA TTTTGTATTTTGTTCATAATTTTTTTGGTAAATTTTTTTTTGCCTTTTTTCTTATCTATATTATTCATTATTATCTTATA TTTTCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200377: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003772320619AA5503671513m3gmbPfHB3.1, G. Roman Reddy


Date: 11:50:48 on Fri 24 Nov 117.