EST 1200379 is a singleton


Sequence

>1200379 (1 EST) Length=618 GGAAATAATTGTGTTAATGTCAATTGTACAAAGAATACATCAAATGAAAAAGATGTTTTTAATAGTAGCGTTTCAAAAAA AACATTAAATGAAAATATGAGTATTGAGAGACCAGTTATATTAAATAATTCACAAATGTTGGAAGCATTTATTCAAGGAA GATTATGTTTAAGTTGTGATTCCTTAGATCACCCTATGCCATTATGTCCGAATAATTCTTTTGTATGTCCTAATTGTCAT AACGTTTCACATAGAGGAAATGATTGTCCTATGAAATGCCGTTTTTGTTTAAAATATCATATGGGTATTTCTATAATGGA CTGTTTAAAAAAAGCAAGGATACAAACGGAGAAGAATAATTCTAATCATGATAAGAAGGATAATCATAATAGTAGCTGTA GTACTAGTAATAATAATATGAATAAAATTAACAAAAATTCAAAAAGTAATGATGAAAAAGTTAACATCGGTCCCCGATTT GATATTAGTACAAGACCAGATAATTCATATGGTAGAAGTGTTTATGTATCTAACTTAAGTGAAGACATTTCGAATATACA ATTAAGAGATACTATTAATTTACATCTAGATAATGGGTTTGTAGTAAATATTGACAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003792320621AA5503691515m3gmbPfHB3.1, G. Roman Reddy


Date: 22:0:39 on Fri 17 Nov 117.