EST 1200386 is a singleton


Sequence

>1200386 (1 EST) Length=697 TAGATTCTGAACTCTTATCTAACCATTCATTTATCTTTTCAATCCTGGAATTTATTAGTTCATGCTTTTTTCCGCACACA GAATCATATTTTTGTAACATACTATATACTCTACTATTCAATACATGTAATCTATCCTTAAGTCTGTCTGCTTCTAAAGA TTTTTCTTCAAACACCTTTTTAGCATGCAACCTTAACTTGTCATAATTTATCGAATCCCTACAATAATCCCAATCGCGCG AACCTTTTCCTAGTAATTGAACTTCGACATAACACCATTCTCTTCCTAAAATGGAAAGTATAAATTATGTAAAAATATTG ATACGGTCTAATATATATATATATGTATATATTTATTTATTTTATTATTTTTTTAAGGAACCGCTTGTTCCGTCAGGGGA TAGAGAAGTAGTACAATTTGTATAAGTCTGATCATCATGAAGAAATGCTGCAGCACATAATCTTCCATCTAATGTTTTTC TATGTTGTTGCCTAAACTCTGTTATTTTTTCAAGAGACGTTTCAGGAGCTTTTGTATTTACAAAGAGACTTTTAATGATG TAAAAAAAAGGCCAACACATGTTATCTTTAACATTATGCCATTAACGAGAAAGATAAAATAATATATCCATTAATAATAA CAGTAGCATTATTATAAATAATGAAGATCTTCATAATATGACGGATAAAAAAAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200386: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003862320628AA5503761522m3gmbPfHB3.1, G. Roman Reddy


Date: 10:37:20 on Mon 20 Nov 117.