EST 1200389 is a singleton


Sequence

>1200389 (1 EST) Length=578 TTTCTGTTTTCCAATTTTTTTAATATGTCCTTTCTCCTATTATATATTTCATCATTTTTTTTATTTTCTTCTGCATTCTT AACAAACGAAAATCTTAACAAATTTCTTTTTTCAAATTCATCATATATTTTTTTTTTTCATATTTATATCCCTCAATATA TCATTATTAATTCTATTAAAAATAATCTTCTTTTTGCTAGAACTTGTGCAAGTTTCAACATTTTTTTTATCTATTAATAT ATCATAAAAAGAGTTTGAATGCCTTTTACTCAAATGTTGTATATTTTCTTCATAACCATCATCAATTTTATGCAAAGGTA ATAATATACTTTTATTTTTGTAATTCACATTATTATCGTCATTACATTTATGATCAACAGTTGACGATTTATTATTTTTT TTATATTCATTATAATTTTCGTCTTTTTTTTTCTTTTCTATATGCTTATCGTTATCTATATTATCATTATTATATTTTAA TGCATTTTCTATTCTTGAATTTTTATAATTTTCTTTATTGTAATGAAGTAATAAATTATTGTTCATCATATTATTTATTC TTTCTTTTGAATCATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200389: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003892320631AA5503791525m3gmbPfHB3.1, G. Roman Reddy


Date: 7:5:48 on Mon 20 Nov 117.