EST 1200394 is a singleton


Sequence

>1200394 (1 EST) Length=604 CGGTTCATATATAATATTATCATAACAAATAATATGTATTTTATATATATATATATATATTTTTTTTTTTGAATATATAA TTTCACAGTGATTTTTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATCTCCAAGTTGTATTAAAAAGGTTAAATATT TTGTATATTATAAAATATCAAATAATTGTGTATTATATATATTTATTTATTTTGCCTTTAATTTTTGTACGATAATTAAA AAAATGGAAGATAATAAAGAAGAAAATTGTGAACTGAATAAGAACAGTTATCCAAATTTTCACCTAGCAGATTTATTTTA TCTTTTACAATTACCTAATATATCAATAAATGAAAGGAATGATTTATTACAATCTCTTTTTGATGAAATAAAAAAAAATC ATATGTATCCATATTATAATTATATATGTCAAGAATTAAATTTAAATTTCGATGAAGAATTTTTTAAAAGTTTAAAAGAA AAAGCAGATGAAGAATTAAACCAAATAGAAAATAAACTGTCCGAGTCAGCTGAAAATTTTGATTCCTTAGATAATAAAAA TGATGTTTTACTGAAGGCAAATTTTTTCTGTAAGATAAGTGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200394: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003942320636AA5503841531m3gmbPfHB3.1, G. Roman Reddy


Date: 20:28:29 on Tue 21 Nov 117.