EST 1200395 is a singleton


Sequence

>1200395 (1 EST) Length=573 TTTCCCTATTTGAAGGAATTAAATATATAGGTCTTTTTGTAGAATATCTATGCCCTTCTTTAGTTCTTCTCAACTTATTT TTAATGGAAAGGAACTTATATTTTGACAATTTTGTTTTCACTCTGCTTAAATTATAAGCACATTTTAAATTTATTAATAT ATTTCTATCTATTTTTTTCTTAAATTTTCTTTTCGAGAATAATTTTAAATTATTTTTCATAACATGATAATTGTTATTTT TAAGATCATTTTTGTAAAGAACGTTACAATAATTATTATTATTATTATTATCATCATTATAAGAATTTTTTTTTTTTTTT CTCTCTTCCATTTCTTTATATATTTCTTTTGATGGTATAAAAAGATACCCATGCTCTTCCTTATTCCTAATATTTTTTAT ATATTCAGAATAATTATCTGTTTTTTTGATATTTGTATTAGCTCCCAATTTTTTCATCAAATAATTATTTGTATCTATAA AATTAGCAAACATTTCTTTATTTACTTTTCCTATATTATTATTCATCCATAATTTTTTACCTCTTAATTCACCTTTATAC GTTTTGACTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200395: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12003952320637AA5503851532m3gmbPfHB3.1, G. Roman Reddy


Date: 2:46:47 on Sat 25 Nov 117.