EST 1200408 is a singleton


Sequence

>1200408 (1 EST) Length=305 TTTGATGTTATCTTTACCTTTTATGTTATCCTCACCTTTTATGTTATCCTCACCTTTTATGTTATCCTCACCTTTTATGT TATCCTCACCTTTTATGTTATCCTCACATTTGATGTTATAATTTCCATTTGTATCATACTTTGTAATATAATTTTTATTA TTGTTAAATGTTTCCATCATTTTATATGACGATAATAATTTCACATGTTTAGGATAACTATTTTTATCCATATGTCCATT TTGAAGGAATTCATTTTTTGTGTTTTCTTCTTCAAGGTTGTATGAATTTTTAATATTTCTATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200408: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004082320650AA5503981546m3gmbPfHB3.1, G. Roman Reddy


Date: 13:3:18 on Sun 19 Nov 117.