EST 1200414 is a singleton


Sequence

>1200414 (1 EST) Length=342 TAATTTTTAAAGAATGATTCATATATAAAAATGTAAGAATGTACGAAATATAAAAATTCTTTCATTTGCCTTTTTTTTTT TTTTTTTTTTTTTTTTTCTTTTCTTTTTTTTTTTTCCTTCTTTCTTTCTTTTTTTTTTTTTTTCCCCTTTTTCTTTTTTT TTTTTTTCCCTTCTTTTATTTTTTTTTTTTTTTTTCCTTCAATTTTTTTTTTTTTTTTTTTGGCTTTTTTTTTTTTTTTT TTTTTCTTTCTTTCTTTCTTTTATTTTATTTCATTTCTTTCTTTTTTTTTCTTTTCTTTTATTTCCTTTTTAAGAGTAAG AATCACAAAACGCATTATCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1200414: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004142320656AA5504041552m3gmbPfHB3.1, G. Roman Reddy


Date: 21:13:46 on Sun 19 Nov 117.