EST 1200421 is a singleton


Sequence

>1200421 (1 EST) Length=370 TATAGGGATAAAAATCCCCCATGAGTTTTTTCTGATTCATACATATATGCTCAATTTTTTCATCAATTTCTTTCCTGTTC ATATCCATTATATTGTTTATGTCTTTTATTCGTTTTTCTACATATTCCTTAAAATTAGTAATATGTTCCTTAACATCTTT AATATCATTGTTGACCTTTATAAAGAAAAGAAAAAATATATAAATAAATATATGAATAAATTAATAATGTGTATTTCTAT TTATACATATGTATAATCTTTATGCCCTTGAATATTAAAAGGAGAGGGGCATATATATATATATATATATATATATATGA ATTTATTATTACATTATTGAGGGACACTTCCATACTCTTCCTTAATGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200421: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004212320663AA5504111562m3gmbPfHB3.1, G. Roman Reddy


Date: 12:36:55 on Fri 17 Nov 117.