EST 1200427 is a singleton


Sequence

>1200427 (1 EST) Length=523 TACATATTTATTACAAATATATATAAAATAATAAACAACTAATTATAATATACATACATATATTACATTCTTTTTATAGG AGCATAACCAGAGGAACCATAACAGTACCACATATCATACGACAATATCTAAACGAACAAAAACACATAGATCATTATGC GAATGCGACCTATATATGCCTAATTATGAGAATGACCCACAAATGAAAAAAGTAATACAACAATTTGAGGATCATACATC ACAAAGGTTTCATGAATATGACGAAAGGATGAAAACTACCCGCCAAAAATGTAGAGAACAATGTGATAAAGAAATCCAAA AAATTATTTTAAAAGATAAATTAGAAAAGGAATTAACAGAAAAATTTGCCACATTACAAACTGATATACATAGTGATGCC ATTCCAACATGTATTTGTGAAAAGTCTATAGCAGATAAAACAGAAAAATTTTGTCTTAACTGTGGAATGAATGTGGGAAT TGCTGTTCCAGGATTGGGGTTGTTAGGAGCATATGGTACCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200427: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004272320669AA5504171568m3gmbPfHB3.1, G. Roman Reddy


Date: 23:17:50 on Sun 19 Nov 117.