EST 1200433 is a singleton


Sequence

>1200433 (1 EST) Length=365 TAACTTTTTAACTTTTTCTATTTGTTCAGGTGTCACCTTCTTGATGTTCATCTCTATCACCGTATTTTCATCATCTCATA TATTAAAAAAAGAGAGAAAAAAAAAAAAAAAAATAAATAAATAAATCATAATATAAATAATATATGTAATATATGTAATA TACATAATAAGTCCAAAATAGAATGATAAAAAAATGATGATAATGAATAAATATTTCTTTGTAACAAACCTTTATGTGAT GTTACTAGATGGATATTTTCTTGTATTAAATATTTATAATTAGTTTCTTGGAAATCTTTTAAGAATATTTGTTCATGTAT AATTTTATTAGCACTTATTAATTTTTCGACATATATCATAGCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200433: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004332320675AA5504231574m3gmbPfHB3.1, G. Roman Reddy


Date: 12:2:25 on Fri 24 Nov 117.