EST 1200444 is a singleton


Sequence

>1200444 (1 EST) Length=582 TCATTANTATAATTATTATATATACCACAATTATTGTCAGATGTTTTCATGAGTATTTTTTTCTTGTTTAATATCAAGTT ATCTTTTTTAATTTTCTTCAATTTGTTGAATAAATCTAATATTACTTGTGACACATTCATTTTTAAAAAATATTTTTTCG GAAAAAAAGCATCAAAATACATATAAATAGTTTTATTAGAAAAATCATAATGTAAACAAAAATATTTATATATAATATCT TGTATATATAATTCATCTTGTGCAGTAAAAATTTTATGAAATTTCTCTATAAGTTGAACCATACATAATAATGAATTATT TTTAGATGGTACTTGTGTTTGTATATCGAAATCTATACTAGTATTAAATATATCTAAATATTCCTTATAACTTATGACAC CAATATTTATATAATTATCAATTAATGTTTTTATACTTTTCTTTTTAATTAAATTTACAATACCATGTACACATAATAAT TCACATTGTTTTACATTATTATTAATATTATTTAAAATTAAAAAATGGGTTAATTCTTTTAATACATTCTCTTTCACCTC ATTATCTAAAAAGATACTATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200444: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004442320686AA5504341586m3gmbPfHB3.1, G. Roman Reddy


Date: 21:22:16 on Fri 24 Nov 117.