EST 1200447 is a singleton


Sequence

>1200447 (1 EST) Length=493 TGATATTACATATTTCTACACGTATGATTCGAAAATTGTATTATTCCGTTTTTAAATTATTTATATAATTTTTTTCCTAA TTCTTATTTTTTTTTTTTTACTTCAATTTTTTTTTTTTTTGTACAGAAAAAAAAAAAAAAAAAAAAAATCCAATTATTAA AGTACATCTATTTTTATGAGTAATATTTAACAATTAATAATTGGAAAAAAGAAGTTAATTATTATAACAATAAATTAAAT TATTTTAACGAATAAGTGACAAATATTATATTATAATATATTAAAAACAAATTCCTTGTGAATAAAAATATGAAATGTCT CGGAATATCTTTACATCTACCACCTCTTACTAATATAATACTATGAGTATTTAGGTTATGTCCTATACCTGGTATATATA CAGATACGATTCTACCCGTAGATAACCTGACTCTAGCTATTTTCTTTAAACCAGAATTTGGTTNCTTTGGTGTTTGAACC CGAACCTTTAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200447: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004472320689AA5504371589m3gmbPfHB3.1, G. Roman Reddy


Date: 6:15:35 on Fri 24 Nov 117.