EST 1200455 is a singleton


Sequence

>1200455 (1 EST) Length=540 ATATAATACATTTTACAATAAACATCCATTTGTTCCTTTTTTGCGTTCTTTTTATATGGATACATTATTGTACATATCCT TTAATATATTTCGTACGAAATAAAATGTAGGATCTAAGGAACTTTCAATACGCCATATAAAATTACTATTGCTATTATGG TCTTGCTTTTTAAAATTTTCTTTATCTTCATAATTTTCTTGATTTTGATTTTGCACTTTTGTCTGTACCTCTTTTTTGAC ACATGTATTTCCATTAATTATAATCTGATTTTCATCAACAAAATTTAATGATCTATTAAAAACGGAATGTATATTTGTAC ATAGGTTTTGCATATTTACATCCCCAATATATAAATTTCCCTCTATTTTATTATTATTTTCTTCATTCATATCTTTTGAT AATATACATTCTTGTCTATCTGATGATAAACATGAATCCGAAAAATCAATAGAATCTTCATCAGATTCATCCTCTTCATT TTCTTTATCATCATCAATATAAAAATTTAAAAACCTTCTTTCATTACTTTTTTCATTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200455: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004552320697AA5504451598m3gmbPfHB3.1, G. Roman Reddy


Date: 15:28:13 on Fri 24 Nov 117.