EST 1200456 is a singleton


Sequence

>1200456 (1 EST) Length=665 TTTAATATATATATATTTTTTTTTTGTTGTTGTGAAACGTACTCATAGGATGTTGTATATTTAGTTATTTTATTTTTTTT TACTTTAAAAGTTATTATAAATAGGAAAAAAAAAGAAAATAAATGCATAAATATATTTTAATTATTAAACATGAGAAATT TGATGAAATCATACTCAAAATTATATAATAAATATGTACCAATATTTTCTTTTGATAACAATGAAAATAAGTGTAAAAAA TCTGTATTATTAAAATATTTAAATTGTAGGTACAATTTTGTGTTAATATTTGGAATAATATTATATATCTTTTTACTAGT AAGTCGATTATCACATAATATGTAAATGTATAAATTTTTTTTTTTTTTTTTTTTTCTTTGTGTCNATTAATTTATTTTAT TTATTTGTTTTATTTTTAGAATATAAATATATATGATGATAGATATGGTTCAGAATATATTATAATATTCAATAGAAATT TAAGCGAAACGAGTAGTTCTATAAGTTCAGGAAATAAGAATGAAAGGTTATTAGAAATAAATAATTTTACTAATACTCAA AAGAAAGTAAATACTTATGACAAGGGATTAAATAGTTTGTTTAAAAAAGGTGAAAAGTATTTAGAGAAATTTATTAACAA TGATATGTCAAAGAGATCATCTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200456: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004562320698AA5504461599m3gmbPfHB3.1, G. Roman Reddy


Date: 12:54:29 on Sat 18 Nov 117.