EST 1200460 is a singleton


Sequence

>1200460 (1 EST) Length=405 TATATATATATTTATTTATTCTTTTGCCTATTTTTGAAATAAATATACGCATATTTTCAATATTTAGATGTTTTTATTTC ATTTTATTTAATTTTTGTCATTTTAAACAATTCCATTTTTCATATATAAAAAGAAAAATTATTTATTTCACTTATTTTTA CTTCATTTTTATTTTTTACTTAATATAAATAATATAATAAATCATACTTTAACATTACTTTTATAATTATTGTGTGCAAA TTTGTTCCTATATTATATTATATAACCTGAAGGAAATATGATATCATATCTTATCTACACAATTAAACCTCAACAAGGTA TTTATAAAAATATGGAATAATATAATTATATGTTTCTCTAATTATATTATTGTCATTATTAATACCATGTCTATTACATT TGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200460: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004602320702AA5504501603m3gmbPfHB3.1, G. Roman Reddy


Date: 3:55:59 on Sun 19 Nov 117.