EST 1200461 is a singleton


Sequence

>1200461 (1 EST) Length=574 TTATATTATCATCATTTTTTTTATTATCATCATAATTTTTATCACCTTCATCAATATGAATTCCCATCTTTTCTTTATTA TGGTGTTCATTTATGTTTTCCTCATAAGGGTGATCTTCAAATCCGTATTTGGACGTTACGGGTAAATGTTCATTGTTATT ACTTTCATTTTTATAAAAATGATTATAATCATATGTAGAAAAATCATTTTTATTTTCATCGAAAAGTATATCGATGACAT TAGAATAATTATTAAAATTATGGTCATCATCATCATCATCATTATTATTATAATTTTTTTTTTTTTCTTTATCATCATCA TCATCATGTTGATTATTATTATTATTCATTATATTAGTATTAACGATATGATTATGATTGTTTTCTATATCTTCTAGTTC CATGTCTTCATTTTTTTTTTCATCAGAATACGACATATCATTAAAATATAGGGAATAATGGTTTAACTCGTCAATTATTA TATCATTCCATCCAGATACAGTAACTAGAAAATTGGACAACCATTTTATTTCTAAAGATTTATTACTTAATATNTGACAA ATATGTAATAGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200461: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004612320703AA5504511604m3gmbPfHB3.1, G. Roman Reddy


Date: 10:27:28 on Mon 20 Nov 117.