EST 1200463 is a singleton


Sequence

>1200463 (1 EST) Length=553 AATGGATTACTCCCTAATTTATATATAGTATGAATTCAATATGTGAATTTATAAGATAAGTAACAAAAAAAAAAAGAAAA AAAAAAAAAGAACAAATTATAAAATTCATAAAATCTAATTGACAAATCTTTACAAACTTGAGAATATTTACCTTATAAAA AGAATTTAAAATATATTATACATTTATTAATATGTGTTCTTTTTTGGACAAAATATAAAATGCTCAATTAAATTTTTTTT AATAATATATATTATATGTAACACGTGTACCTATTTATGTATGCTTTCATTTTCAAAACATATATATATGAAAGTATTAT AGAATGTAATTTTTAGATTTTATTAAAAATACATTATTTAATTTTTCTTTTTCTAAATATTTTGAAAGAAAACATAAATA ATTCATTTTTTAGCACAATAATATTATCAGATTAATATTTTTTTTTTTTTTTTTTTTATTGTTTTCACCAAATACACACA AGCATACACCCCATACATTAATTATAATTTAAAAACGGTTCGGGGTAACATTTATTGATGTGAAATTAATTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1200463: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004632320705AA5504531606m3gmbPfHB3.1, G. Roman Reddy


Date: 18:33:48 on Sat 18 Nov 117.