EST 1200472 is a singleton


Sequence

>1200472 (1 EST) Length=465 TTTATAATTTAAAAAAATGTGGACATTACTATTTATCTATTTTTCATAATAAAAAACATATAGCTGAATCTCCATATCTT CTTGAAATAAAACCATCAGAAGCGTATGCTGCAAATTGTGTAATTTATAAGAACGATATTACTAATCAGTTTATNATTCC TTACGACGAAAATGAAGAAATGTTATCATGTGATGATGATAAAAAAATATATGAAGATAATAAAAAAATATATGAAGATA AAAAAAAAATATATGAAGATGATAAAAAAATATATGAAGATGAAAAAAAAATATATGAAGATAATAAAAAAATATATGAA GATAATATAATATATGATTACAATAACATTTGTGATTACAATAATATTTGTGATTATAATAATAATGCACCGTGTGAAGG AACTGTTCATCATGTATCTAACAAGATACATCAGCACGACCGTGAGAAGAAAAAAAAAAAAATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200472: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004722320714AA5504621615m3gmbPfHB3.1, G. Roman Reddy


Date: 20:44:19 on Wed 22 Nov 117.