EST 1200479 is a singleton


Sequence

>1200479 (1 EST) Length=642 TACATATGATGATGTATCAGGTATGTCACTGAATAAACATGATTTAGTTACAAAAGAAAAGAAATATGAAATAAATGATT CGATGTCTGAAATAAGAGACGATTATTTTGATCTTTGGTTATTTTTAAGAGGAGAAAGACATGGAAAAAGAACTTTAATT AATTTATCAAATGATTATGTTGTTATTCCATCTTCACCTTTAGATGATGCGGATGTAATAGAAACTGATGTTATGAGAAA TTGTGGTTTGAAAGAAGATAATCCAGCTTTAAAAGGATGTGATTATAAACATGAATGTAACATTATACATCCATGTTTAG TAAAAGCAATGATGTTACCAAAATATCTTTTTGATTTAAGTGGTAAAACATGTAATAAATTAGGTGTATCGTTAAATAAA TGGAGAAATTCTGATGGGAATTTTTGTGGTTCTTCAGCTGGGTATTGTTTATCTGAGAATTTGTTTAAATATTATTACAT ACATAAAACATCTGTTGGGAATAGAAAACCTTCGAAATATAAAATTAAAAATATATATGGGTCTGAACCACAGACAAAAG TCTATACATCTGCAAAATTACCTAATTATTTAAAAGATAAAGTAAATAGTAATAATAATAAATCTTATGATATTAATGAT AT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200479: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004792320721AA5504691623m3gmbPfHB3.1, G. Roman Reddy


Date: 15:19:51 on Fri 24 Nov 117.