EST 1200481 is a singleton


Sequence

>1200481 (1 EST) Length=622 ATCACTATGATTAAAACCAAAAACGTTCATACTTTGATTTAAGGTTGTTTTTTTATGTATAGACAAAACGGTTGGATATA AATATCCAGCATATTCTGTATTTTTAAAAATAAATGTTAATTCAGGATTCAAACCTACAGATATAATATCTTTTACATTT TCATTAGTTAATGTATTAATATATTCTAGTGAATAATTTTGATTAAATAAATATTTTTCATCATCTGATAATTGTATAAC TAATGGAACATTAAAAGCTTCTTGTAGATATTTACAAAAATAAAATGGTATTAAATGACCTAAATGCATAGATAAGGAGG ATGGTCCTCTACCCGTATATATATAGAAACATTTATGTTGTTCATAATAATTTAACAAGAAATCTAAATCTCTATGACTA AAAAATATTCCTCTTCTTATAAAATGGTGAGCTTTACTATTTGTTAATTTTTCAATTCTTTTAATATGATTTTCTGTAAT TTTGGAACAACCAAATTCTTTTATTAATTTATTATAATTAATTCCTTCTTCATTGTTTATATTTACATCCCAAGGAGTAA CATCTTTAGAACGTTCATAATCAATATTTTCAATTCCTGAAGGTGGAAGTACTTTGTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200481: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004812320723AA5504711625m3gmbPfHB3.1, G. Roman Reddy


Date: 6:17:15 on Thu 23 Nov 117.