EST 1200497 is a singleton


Sequence

>1200497 (1 EST) Length=493 TAAAAGATAGGAATATTATTATACTTTTTTATTTTAAATTTTAATTTCTCTATATCATTTTTATTTCCATTCGAAGGAGT AATATCATAATTGAACTTGCTATCATTCAATATTTTATTTACATAATGAAGTACATTTTTATCATATTCATAATCAGGAT TAAAAATTTTTTTTTCTACAGTTGATTTATTAAGTTCGTTTGATAAGCTTATAATAGAATCTATTAAACTATTACTTGTT AAGGTTCTTTTATTATAAATATGAAAAGAAGATTTTTTGGATACATCTCTTTTTATATTAACATATGCATTATTATTAAT TAAGGGATATAATTTTAATGATTGACTATTTGTAATACTATCAACATAATGTATATTATTTACATTTTTATTATTAGTAT CATATAATGCATAATAATTTTGAGCACTATGTTTTTTATTATTAATATGATTATTATATATATCGTATATATTATTACCA TATATTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200497: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12004972320739AA5504871642m3gmbPfHB3.1, G. Roman Reddy


Date: 22:59:28 on Wed 22 Nov 117.