EST 1200504 is a singleton


Sequence

>1200504 (1 EST) Length=691 TGTAAACATTTTTATTTTCAATTTTATTTTATTTTTACTATCCGAATAAGGTTTTTTTAAAAGGCACTATCTTGATTTCG ATAAATTGGAAAAGTTAAATGTGCAGGATGAAAAAAATAAGGATATTCCAATCAATGAAAAATTTATTTATCAAAAAAGT TAGAATATAATTTATGCCTATATTTATTTATTTTTTTTTTTTTTTTTTTTGTAAAATAACATTATTGATTATATATATTA TTTTTTATTTTATAGAAGATATATATTGTTGTATGTTTGCTGAAATGTTTAAAAGCATAATTAGAAATCATATAAAAAAA TACATTACATATCTCTTAAAAATAAATACATGTTCAATACAAGAATTTGAAAATATATTGGAGGACGATCTAATCGATAT AATGACAAGTTTGTTTAATATTATTTAAACAAAACGTTAAACAAAAATATATATTTAATAAGTGTAGTTTTTATTTACAC GAGTATTATATTATTTATTTTATTTTTAGGAAATAAAATTTTGAATTCAAATCTTCCAGTGGAATATGATTATACATTTT TGAATCCAACGATTATATCTCATTTTTTCTCACACATGTTCACAGATATTATTGATAATCTTATGAATGAAAAAATTAAT TTTAAAAAAAGGGATGATTAAAAAAATTACTAAAAATTAAAAAGTTTCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200504: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005042320746AA5504941649m3gmbPfHB3.1, G. Roman Reddy


Date: 4:36:13 on Sat 25 Nov 117.