EST 1200516 is a singleton


Sequence

>1200516 (1 EST) Length=717 TGTATTATATATATAACCCTTTGTGCATTTTAACATTTGATCATCCCGTAATTCTTTATTTTTGAAGGAATATGGAAAAG ATGGAAAGTTCTTAGTGTTTGTTGACTACTTATTTTTTTTTCATAATAGACGTGAGCTCATAAATTTAATTATTTTTTTA ATAGTTGTAAAAAAGTTATCAAAAACTTCTCAGCGTTATAGTAACTCAAATAAAAATAAGCAGAATAATGAAGAGACCAA TGTTTCAAAAATAATACCGTATGGTGATAAAGAAAAGATAAAAAAAAAAGAAGAAAATGATGCTGATAATAATACAAAAC AAAATTTAAATGAGGTGAAGGATTATAATTATTATAATGAGCTTTTAAAAAACCAAGAACATTTAATTAAAAAAGTAAAT TTTATTAAACATACTTTTAAAATAGAAGAAAACATAATAATATCAGTATTTTCAAATTTTGAAGAAGACGATGTTGTTGA AAAGAAAAATGATCACTCTAAAAATTTAATAAAAAGTTTATCTGAATTGAATGTATGTTATAAGGATGTAATAATAGCTA TTGCTGATAAATATATTTTGAATAATGTATATTATATGTGTAAAACAGAATTTCAAGGTAAGAAATAAGAACAAGCAAAC ATAAATATATATATATTAAATAATTAACAAATATATATAATAATATGGTATTATTAATATATTTTACATACATATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200516: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005162320758AA5505061663m3gmbPfHB3.1, G. Roman Reddy


Date: 21:38:42 on Mon 20 Nov 117.