EST 1200518 is a singleton


Sequence

>1200518 (1 EST) Length=618 TGATCTTATTTTTTAGAAATGGAATAACTGAAAATGGTGTTAGAATTTTGACAACGGATAAATGTTCATGGTTAGTTATT AAGTGAAAAAATTACAACATATATAGATAAAAAATATTAATGAATGTACTTGTATTTATTTATTAATCCAACTCTTTATT AATATTATATAATTGCAAATACTCCCTTTTTCAGGTTATATGATTATTATAGAATAACCAAAACATCAGATCCATGTGTT AAAGAATTAACTGGAAATACTACTGTTGATTATTATTACTATACTACTCCGTTTTCTACCCAAATAGGAAATATAAATTT AGTTATGATGCATAGTCAAGTAAACTTTGGAGATGGCACTTGTGCCCCTGCTGATCGATTTTTCAAAATGAATTCAACTA CTCCTGAGATGATTAAAGAAGCAAAATTAAAAGCTAAGAATTTTCAATATGAATGTATGCAATATATATAGACTAATTTT CAGAATTTTTTTTTCTTTTTGAATTTTTTTCTTTTTTTATTAAACTTATAATACATCTCTCTTTTTTTTTTTTTGTTGTT CATAGTTCTTGTTTCCAATTTTTTTTTTTTTGTTGTTCATAGTTCTTGTTTCCAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200518: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005182320760AA5505081665m3gmbPfHB3.1, G. Roman Reddy


Date: 4:18:1 on Mon 20 Nov 117.