EST 1200524 is a singleton


Sequence

>1200524 (1 EST) Length=650 AAAAAGTTTGAAGCATAATTTACAAACGCCCTCTTCTCAAAATAAAACAAATGATCCTCATCAACACACACCCCAACCCC TTGAAGAAAATAATAATAATAATAATAATAATAATCCATATTGTAATGTAAATCAAGAGGAGAACCCAGATATAATAAAC CAATGGGATAAAAGCAAATCAGATGGAAGCACATGCAGCTCTTCTCATTCCATAAGAAATATAGAAGACACATTATCAGA TATATCATTTTCATCATCTTGCGAAAAAAAAAAAAAAAAAATTAATAAAAATAAATCTGAAAAAAGAATTAACCGTAAAA AGTGTGATAAAAAAGATTGTCTAAAAGATGATGAAAATATATCGATGAACAAAAAAAACAACGATGTAAAAACAAAACAA AAAGGAAATAAGGTTAACAAAACAAATGAAAAGAACAATATAAATAATAAAAATCTGCCGAATGGAGAATATGATCATAT ACCTTCATACAGAAACGATTACAATGATGAACAGAAAAAATATATGTTTATACGTACTGTAGAAAAAGATGTAATTAATT TATTTAAAAAATATATATTAATACATATATATAATATAAATAAAATACATGATCATGTAATTAATAAAAGAAGTAAAGTG AAACATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200524: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005242320766AA5505141672m3gmbPfHB3.1, G. Roman Reddy


Date: 10:2:46 on Wed 22 Nov 117.