EST 1200529 is a singleton


Sequence

>1200529 (1 EST) Length=748 AGAAATAGGGATAAAATATTATTAACAGATAATTATAATAAAGCATTTCTATTAAATGTTTATGATTTACATCTATCGTC ATATGATTCTAAAGGTACACCAATTAATCAAATAATTCACTCATCCAAAAATATTACTGGTATAACAAAATTTCAAGAAA ATAAAAAATATTTAATTGTGTGTAGTGAAAATGGAAAAATGAAAGTTATCAATAATGATGTATTTCTAAAAAGGAAAAAA AAAGGTATCAAGCTATTTAAAAATAAAAAAAATATTTATTTCAGTTATTGTAATTTTAATGATAATTGTATAGTAGGAAC CAAAAATGGGTATATCATACAGTTTCCATTAAGTAGTTTTAAAATATCAAAGAAAAATTCCTTAGGTAATAAATGTATTA GCCTTGCAAAAAATGATAAAGTAGTTGATTTATTATCATATGAAAATAATGAAAAAAACTTGAAAAATTATAAAATCATA TTCGTAACTAAAAATGGATTTGGAAAAATGATTAATTTGAATGAATTAAAAATTCAAAAAAAAAAAGGAAAAGGACATAG AATCATGAAATTTAAAAAATCGAAAACAAGAAAGGATAACAAAAAGGATATAGAAAAAAAACAAATCAATGCAATTAATA ATAAGGATAAAGATAAAGATATACCATCAAATAATGATGATAATAATATTTTACATAATACTAAAGTGGATGAATTTTTA GGTTTCAAATTATATGATATGAACAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200529: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005292320771AA5505191677m3gmbPfHB3.1, G. Roman Reddy


Date: 9:32:29 on Sun 19 Nov 117.