EST 1200543 is a singleton


Sequence

>1200543 (1 EST) Length=422 GTATTACTAAAGGAAATAACTCTTGCTGAATTAAATTTTCACTATATGCATTAGCAGTTCTTTTAAACGAATTTATAACA TATTCATCTAAATCAACTCTTGGTATGTTATATTTTTTACAAAACAATTCCATGCTATTATTTGTCTTCAACTCTTTATT GTTCACCATGAAATCATAACCATCATGTATAATACTATCTCTTAATATATTATTACCTAAACTATATTTCTCTGTTCTCA AGTTTTTTAAAAAATATGGACTTTGAGACATGCATTCCATAGAACCTACAACACATGTATCTTTACCCCCCCTAATTAGA TCATATCCAATCGTTATAGAATCTAAACCACTACAGCATAGATTATTCACAAGATAAGTTTTGGTATTTATATGCATACC TACATAATGACGTAATATATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200543: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005432320785AA5505331695m3gmbPfHB3.1, G. Roman Reddy


Date: 21:17:11 on Sun 19 Nov 117.