EST 1200545 is a singleton


Sequence

>1200545 (1 EST) Length=434 TTATATGGAGGAAATAAAAAAAGTCTCAAATATTATTCAGGGAAAAAGCATCGATTGTTTCGAATCTAATTCGACTATTG ACGAAAATAAAATAATGAATGTAAACGACATATGTAATATATATATGGTTGACAAAACTTGTGAAAGAAATAATATCTAT AGAAAAGATATAGACAAAGAATATCTTCATGAAGAAAATCAAAAAAAAAAAGATAAGGAGAAAAATTTATGTGTTCAAAA AAAAGGAGATATAATAGAATCATCTATATCTAATACAAATGATATTATTAAATGTAATAACAATTCAAATGAATATAATC ATAATATCGGAAAGGATAAAAAGTTGGAAAAATTCAAGTCCTTCATCATAGAGGACTCCAATTCTTCGTCTTCTGGAAAA AAGAAATATAATATTAATGATGTATATAAGGTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200545: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005452320787AA5505351697m3gmbPfHB3.1, G. Roman Reddy


Date: 2:13:25 on Thu 23 Nov 117.