EST 1200548 is a singleton


Sequence

>1200548 (1 EST) Length=556 TAAATTCATATTATACGTATTTTCTAAATTTTCCATATCTTTCTTTAACTGAACAATTTTTATAGCTTGCTTTTCTATAT ATGCATTAGCTGCATCTAATCGTTTTGTTTGTGATTGTAATAAAAATGAATATTCTGTTTCTTTTTTTATGCTCATATCT AATTCATTTTCTAGTTGATTAAAAAAAATCATTTTCTGATTTTTCAAATTGTTTATTACATTATTTAATTCGATAATTTC ACTACTTTTTAATAACAATGTATCTTTCAGTTGTCTATTTTCAACTTCAATAATGTTTAAAGGTTCAGCACCTGGCAGAT TATTCTGAATGTACACATTACTACAACTACTACTATTATTATTATTATTGTTTTTATTGTTTTTATTGTATTTATTTAAG TCACTTATATAATTCTCTATTACCTTTTCATATTCCTCATTTTTTCTTTTCTCATTTTCCAAATAACTATTTTTTATTTG AACTTCACACTTTAATCGAAATATTATATGTTTATAATTTATAATGTCATTTTCCATAGCTTTATATATTTCATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200548: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005482320790AA5505381700m3gmbPfHB3.1, G. Roman Reddy


Date: 11:55:4 on Wed 22 Nov 117.