EST 1200552 is a singleton


Sequence

>1200552 (1 EST) Length=502 ATATATATATATATTATATTTAAATATGTAATCATTTGTAAATCAAAAAATATATATATATATATATATTTGAATATAAT TTCATTTTTTATACATTAGTATACATATCTAACAACACACTTTTATTCCTATTATTAATATTTTATATTAAATCACATAT TACTTTTTATGAACTTTCTTCATTAACAACTTTTCATTAAATAGCTAGAAAAAATGAAAAATTCTGAACAAGTCAGAATT AATTTTAATTATATATATTCAAATAAGGAAATTAGAAATGACGTATACCTACCAAGTAGTGATACATTTACATTCGTTGA AGCTTTAGAAGAAGAAGTTGATAAAATTTCACAAGATATTAATATCGTCCTGGAAATGGGGTATTTATAAAAAAAAAAAA AAAAAAAAATTATTCAAGAATGTATCTTTTTTATATATGATACATTCATTTATTTTTGACATTACCTACAAAAGTACTTA TCTTTATTTATATTTTCCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200552: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005522320794AA5505421705m3gmbPfHB3.1, G. Roman Reddy


Date: 10:6:3 on Fri 24 Nov 117.