EST 1200554 is a singleton


Sequence

>1200554 (1 EST) Length=539 AAATTAAATTTAATTAATATGATCTAAATATTTTTTCTTATAATGCAGAACAATATTTACATATGCATTTATAAAATTTT AACAAAAAAAAAAAAAAAAAAAAAAAAAAAACATATACATATATATATATAATTTTCTTTTTTTTTTACATTTTAATCTT CCTATGGGACATGTTATTTTGAATTGATACGTAATAAATAAATAATATGCCAATTATACAATCGGTTTTCTTTTTTTTTT TTTTTTTTTTTTTAACTAAAATTACTTTTCATTTTTTAATTTTTCCTGTATTTCCTTTTTCTTTTGAGCTTTTACAGGGT CATAATATAAGACAACCAAATATCTACCAGCTACATTAAAGCCTGATAAATGATCCAGCGCATTTTTTGCATCATAAATA TCATCATAAACAACAAAAGATGTTCCTTTTGTTCCTTCAGCATTTCCTTTTCTTATCTGCCTTACTGTTCCATATTTCCC AAAAATATCATATAATTCATCTGCAGATATCTTATATGGTAAATTTCTGATAATGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200554: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005542320796AA5505441707m3gmbPfHB3.1, G. Roman Reddy


Date: 2:28:8 on Mon 20 Nov 117.