EST 1200558 is a singleton


Sequence

>1200558 (1 EST) Length=678 TATTTTTTCTTTTTAGGAACTATGGCAAATACTCTGTTCTTTTAAAACAAAATAAATAAAAATGTGTAAACATATCCCTA TTGTTATGAATTACACTTTTATTTTAATACATACAAAATTATTTTTTTCCCCCCATTATATTAATGGATATGGTTTTATA TTTTTTTTTTTAAAAAACATCAAATAAATATTTAAAAAGTAATGACACATAGACTTGGGAAGATTAAAATATAAATATAT GACAAAAATTTTGATACTTTTATATAAAGTGTATAAAGATAAATGAAGAACAAAATGAATATGTTCATTTAAATAAAAAA AACATATTTTCAGAAAATATAAAAGTAAAACTAAATCATATATATATGAAAAGCTTTTGTGACACATATTAATACTTTTA TACCCATTACCAATTTGGATAAATTTTTTTAATTTGGGAATATATTCCTTAAATTTTTCTTCATATATATATAACATATG TTCATACCATTTATCATATAATTTTATATTTTTTGAATAAGAATAACAATGAAACTTTTGTATTAAATCATTTTGAACAT ATTTCTTAACCCAATGATATATTCTTAATTTTCTTTGGATAACTTTTTTATTTCTATATATTTCCCCATAACATCTAATT ATATTATACTTTATAATATAATCTCCAAAAAAACATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200558: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005582320800AA5505481711m3gmbPfHB3.1, G. Roman Reddy


Date: 6:28:5 on Thu 23 Nov 117.