EST 1200564 is a singleton


Sequence

>1200564 (1 EST) Length=675 AGAAAAAACATTCTTAGATAATGTATTATTACAAGTTAAGAAAAAAAATATAGCAGGAAATAAAAACACTGTTGAAAAAT CAGCTATTAATGAATTGAATAAATATAAAAAAAATATTGAATTATTAAAAAGTAAAGTGAGTGTAGAAGATAACACTGAT AAAATTGTTAAGTTGGAAAATAAAATCAAAGAAAATGAAGAAATATTACAAAAATTAATTAATGATAAAGAAGGTTTAGA AAATATTTCAAAGCAACAATTAAAAGCCATAGATGAAATATGTCTAAACGAAACACAAATATCTATACAAACAAAATATG AAGAAATTCGAAAATTAAAAGAAGATTTAATGAAATGGAAATTTACATATAATGAAAATGAAAATCTTTTAAAGAAAAAA CAAGAACAATTAATTCATATAGACAATCAATTAAAAAAAAAAATATTTACTATAAAAAATTCAAAAAATAATAATATGTC CAGTGGAAATTCTAATAAAAATTTGTCAAACATTCATATACAAACACTTAAAACACAAATTGATATGATTAATGACAATA TAGCAAATGATACACAAATGTATGACGAAAAAATTCAACAAATTCAAAACAACATAAATTCAGCTCAAAATGATATCGAA TTTTTGAATTCACAAATAGAAGAAATAAAAAAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200564: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005642320806AA5505541717m3gmbPfHB3.1, G. Roman Reddy


Date: 0:38:4 on Sat 25 Nov 117.