EST 1200565 is a singleton


Sequence

>1200565 (1 EST) Length=361 TTTTAATACATATCAAATATATTAATCAAAATAAAAAGTGTAAAACAAACTTAAAAGAAAATGACAGCTAAGTTAAAAAT GAAGGATTATGAAAACCTTTGTATATGGTTTAAAAGATTAAGTAACAGAAAAAGTTTACCTCTCTTGGCTGAAAAAAAAT AAGATCGTCTGAAAAAGTTTACCAACTTTTCATTATATCATATTATGGAAAAATATGAATTTGTACCTAACTTTATTTTA AAAACTGAATTCTTATATCCTTTATTATATAAAAACCCAGAAGTGTTAAAGCAATCATATTTTAATCATCATAAACTTTC AACTGAGCAAAATAAAACAGAAATTAACAATCCAAAAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200565: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005652320807AA5505551718m3gmbPfHB3.1, G. Roman Reddy


Date: 13:4:19 on Sun 19 Nov 117.