EST 1200574 is a singleton


Sequence

>1200574 (1 EST) Length=580 GTTTTTAAAAAACAACTTGAAGGTGTTAAATATAAATTATTTTCATATGGACACATAATACCTACAAATTCAATTTCTCC ATCGCTTCTTATAGTACACTCTTCTTTTTTTAGATCATCTATTTTTATACTTTTTTTTAAATAATTATATTTAGCAGAAT TCTTATAAAAATAACAACCTTCTATTGGATTCCCAAAAGATTTTAAATGTATAGTCATAATGCCGTTATTTCCTACATTC TTATTTTTTATTGTGCTATCATTAATGCATGCAAATTCTATTGTCTGATTCTTTTTTAAATATGGAGGTAGTTGAAATAT GAAGAATCCATTTTCTATACTGTTTCTTTTTCCTATATATTGTTCGTATGTATTGCTACTACTATGTGTTTCTTCGATCC TAGATTTGGTAAGAGGCACCGATTTTGGAGATATAGAAAAGCTTGTGTGTGTTAATGGTGTATATATAGATGGTGTATTA AATACAGATGTTGATTTATTTCGTGTTGAGAAAAGAAATGATTTGTTTGTATTATATGTTTTGTGTAAAAAGCTCGTGGG TGTTAATAGATCAGGTTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200574: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005742320816AA5505641728m3gmbPfHB3.1, G. Roman Reddy


Date: 19:14:23 on Thu 23 Nov 117.