EST 1200578 is a singleton


Sequence

>1200578 (1 EST) Length=390 TTTATTTATATTTATTATTTTCCTTCTTGTACATTTGTGAAATGATGTTGCGAAAATGACTAGTTGATCTTTCTAACAAA TATATCCAAAAAACTCTGTATTTATAAAAATCAAAAAAGGGAAAAAGAACAAAAACATTTTCATAATATGTTGTAACACA TAAATATATATAGCATATTAACAAACTATCTTTTTTCTTCTTTATTATTTTTATATGTTTTATTATTAACAATATTACAT AAAAATTTTATTACATATAAAATATATATATATATCATCATTACATCGGTATATAATATATGTATATAATTCTGTATTTT AAACAAACATGGTAAATTCAGTTGTTTTTAAACTATCACCAGAAGGAACAAAACCAGAAACATCTTTACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200578: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005782320820AA5505681733m3gmbPfHB3.1, G. Roman Reddy


Date: 17:15:38 on Wed 22 Nov 117.