EST 1200583 is a singleton


Sequence

>1200583 (1 EST) Length=754 ATGTATTTTATTAATTTTATTTTAAATAAGTGTATTAAAAAATTATACATTTCATGTATTCATGAAATCGTATATATCAT TTAGATCATCAAAAGAGACATTATTTTCATCTAAATTAGATAACATATCTCGCATTAAAATCATATTGAATATATCTATT CTTTGCATATTTCTTCTATTAGGATTATTTGTGAAAGGATTTTCTTCTCCCTCCGGCGATTCAAGATTGTTTTCATCATT CTCATCGTCTTCATAATTTTCATCATCAAAAAAATCATAATTTAAATCATCATCATCGCCATCTTCGTCTTCCATATCTT CATAATCGTCATCTTCTTGATATTCTGCCTCCTCATCAGCTAATTCGTTTATCTTCTCGTTCATATCGTCTTTTTCTTCC TCTTCGGCATCATCCTCGTAATCATCATCCTCATAATCATCATCTTCGTCATCACTTTCAAAATCGCTTTCATCATCACT ATCATCATCACTAAATTCTTCAAATTCATATTCCCATTGTTTGGGTAAATTTTTACCTTTACCTTTATATAAGTTATACA TTTCATGAGGCATTACTACTAGACCTTTTAATTTTTTTTTTTGTTCAATGAATTCCTGCATACTTCCTTTTTTTCTTCCA CGTCGTTTCATTTTTTCGGATTTCTGATCAGTTGGTTTCTCTACCTTTTTAATTTTAATAAGTGATAAGATTTTATCTCC ATGTTGTACAATAATTTCTTCTGCATCATCTGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005832320825AA5505731738m3gmbPfHB3.1, G. Roman Reddy


Date: 13:21:59 on Thu 23 Nov 117.