EST 1200587 is a singleton


Sequence

>1200587 (1 EST) Length=773 CATATTATATTATTTAATTTTTAATTTTTTTGAAAATTTTCTCTGTGTAGGTTAATGAGCCTTTCATTAGCGATAACAAA GTAGAAGATGTAAGAAAGGTAAGATATAAGAAAATATATACCTATGTATATATCTATATGTACTCTGAGAAGATAACCAT GTGTATGTTTATGTTTATGTTATTTTTTTTTTATGTTTATTTTTTTTTTTATGTTTATTTTTTTTTTATGAACCCTACCT AGGAGGAATACAAACTGCCTAGTGGCTATGCGTGGTGTGTATGTGATATAACAAAAGAGAACGATAGGAGCGATATTTAC AATTTGCTGACAGATAATTATGTAGAGGATGACGATAACGTATTTCGATTTAATTATTCTTCTGAGTTTTTGTTATGGGC TTTGAGTTCTCCTAATTATGTAAAAAATTGGCATATAGGTGTTAAATATGAATCAACAAATAAACTAGTAGGTTTTATAA GTGCTATACCTATTGACATGTGTGTAAATAAGAATATAATAAAGATGGCTGAGGTGAATTTTTTATGTGTTCATAAATCA TTAAGATCTAAGAGATTAGCTCCTGTTATTAATAAAAGAAATTACACGAAGAATTAATTTAGAGAGTATATGGCAAGCTA TATATACAGCAGGTGTTTATCTACCCAAACCAATTAGTACGGCTAGATATTTTCATAGATCGATAAATGTAAAGAAATTA ATAGAAATAGGATTTTCATGTCTAAATACAAGATTAACAATGAGTCGAGCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200587: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005872320829AA5505771742m3gmbPfHB3.1, G. Roman Reddy


Date: 1:19:21 on Tue 21 Nov 117.