EST 1200591 is a singleton


Sequence

>1200591 (1 EST) Length=773 TAGTTAATTGGTTACCTCTTAAATGTAAAGTCTCTAAAGAATTAAAAAATAAAATCATAACATCTTGTTCTGTTTTATTA GAAATGAAATTATTCATATAAGCGTCATCAGAACATGAATCATTTTTTTCTCTTTTATTTTTATTTATTATATGTAAATA TTTTTCAAATGTTGTTAATTTTTTTATATTATTATAACTAACATCAAGATAAATTAATTTATTTAAGGGTAAGTTCTTAT TTGTGTACATATTCTTCTCATTTAATATATTACTATTAAAAGAGTCATATATAGATCTATTTCTTGTAACTTTTTTCTTC TCATGATTATTATTATGTTGATTCCTCTTCTCCTGTTCATTGTGATAATTATTCTTTTTATAATTCTTTGTCTTATTTTT TATAATATCCTTCCCACACAAAATATTATCATCTTCATCACAATAAAAATTATTATTACAATTTATGTCATCATTATCAT TATCATTACCTTTATATACATTCTCGTTATTACATTTTTCATACGAATTATTTTCCTCACAAATGTCTTCATCATATTCT TCCTCTACCTTTTCAATTCCCTTAAAACATATATCTGTTAATAAATTATGGTCAGCTATAATTTTTTCCGTACAACATGG AATATAGTCATCATCTAATGATATCACTTCATTATGCGATATATTCAAAACTCTTAAATTTTCAAAAGCTCTTAATCCTT TTATCGATTTTATATTATTATGAGAAACGTTTAAATAAGATCAAGCTTATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005912320833AA5505811746m3gmbPfHB3.1, G. Roman Reddy


Date: 9:31:6 on Sun 19 Nov 117.