EST 1200596 is a singleton


Sequence

>1200596 (1 EST) Length=778 TATTTTTATTATCTCTTAATAATTCATATTCTATTTCTTTCCATCCTTGTAATGATTTATCTATAAATATTTCATTATCA GTTTGTAAAAATATTTTATTACATTTTTCGATAAGTTCTTCTTCATTATTTATGAAACTACTATTTAATCCTCCTAACGA AAATGTTGTACGTACTAATATTGGATATCCTATTTTATTAGCTATATCAATAGCTTGATTAACATTTTTTGCACTACCAT ATGGAGCTATTCTTTCATTAATTTCTTTTAATTTTTCAGCAAATAATGTTCTATTTTCTGTTATTCTTATAGATTCTAAA GATGTACCTAAACATTGACAATTATTCTTTTTCAATACTTTTTTTTGATCTAACATTAAAGCACAATTTAAAGCTGTCTG ACCACCAAATGTACATAAAATAAAATCAGGTTTTTCCTTTTTAATAATTTTTTCTACAAATTCACAATTAACTGGTAAAA AGTATACCTTATCTGCCAAACCTTTTGATGTTTGAACAGTTGCTATGTTAGGATTAACTAATATAACATATATACCACAT TCTTTTAAACTTTTAATTGCTTGTGTTCCTGAATAATCGAATTCTCCTGCTTGTCCTATACATAAACCACCACTACCTAA AAGAAGCACTTTCTTTTTTATATAAATAATATTATATCCTAAATATTCTCTATATTGTTTTTTCTTATTAAAGATATCTA AAAGAAAATTCTTAAATAAAAATGATGTATCTTCAGGACCATTATTACCCTCAGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200596: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005962320838AA5505861751m3gmbPfHB3.1, G. Roman Reddy


Date: 8:39:5 on Fri 24 Nov 117.