EST 1200597 is a singleton


Sequence

>1200597 (1 EST) Length=755 TGATATGTCTATATGTCGGTGGCAAATTGTTTGGATCTTTTAATAAATTATTTATTGTTCCTGAAAATTTATTTCTATCA TAATTTTGAGCACTTTGCGGTATATGTTTTGATAAATATTCATCTTTCGTGTGATCTTTACCTAGGTTGTTTTCGAAATT GATTTTATGTGTTAACCCTTGTAATTGATTTTGTTGAAGTAGATGAGCTTTATTTTTTTTAAAGAAATGTAAAAAAAGAT TATTTATTATATGGTCTATATGTATGTAAGTATCATTCCAATTCATGTGTATTAGATAATTAAAAGGGAGTTTTTTTAAT ATATGACGTAGAACAAATTTGGTTATTTCTAATGTAAAATATTTGAACTTGAATACTTCGATTTGTAAATGTTCTTCATC GGATGGTTCAACTAATGGTATATATTGTTTTATAAAATGGTATAGTATATCACTATTTATGTTGGTACCGTGTATATAAT CTCCATTTTTATCCCTACGATTAACATAATTGGAATCGATATTATTAATATTATTATTATTATTATTATTATTATTATTA ATATTACTACTCAAATAATTTCCGTTGAGATCCTTTTCATATATATAATAATCATCATGAATATAATTATGTTTTATGAT AGGGCTTATATTTATAAATGGCTGTTGTAATATATTAAAAATTTGTTGCTCATAAGAAAATTCTTCTTTTGTAAAAAACC AAAAGGCTGACATTCATATATTTCATCATAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200597: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005972320839AA5505871752m3gmbPfHB3.1, G. Roman Reddy


Date: 2:29:25 on Thu 23 Nov 117.