EST 1200598 is a singleton


Sequence

>1200598 (1 EST) Length=359 TGTATGTAGTTTTTTTTTTTTTTCTTATTGTTTACCTGATGTTGCATTGGTTGTTTGGCATTTTATAGGTATTTGAACAG TTTCTCGTCCTTCAATTTTTATATTTTCAATTGAAACAGAGAAATAGTCATCCGTCTAAAAATGAAAAAAGAAATAATAT AAATTTCTTTTTATTATATTGATGTCTTACTAAATATTATACAAATTTTACCTTAATAAAAAATTCTTTTATATGAAGAA ATGGATTTGTAAATGTTAAAAATGTCGTTTTTTGTGATGAACAAAATATGGGTCCTTTCGGTTTCGGTGATACACTTTTT CCCATTATTAACCCCTATTAAAATTACAACATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200598: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005982320840AA5505881753m3gmbPfHB3.1, G. Roman Reddy


Date: 17:20:43 on Wed 22 Nov 117.