EST 1200599 is a singleton


Sequence

>1200599 (1 EST) Length=764 GGATATTAGTTACAACATATGAGTCAAATCTCATAAAAAGAAAGGCTGATATAGAAAACAAGATTTTTAAAGCGAGAAAA AATTGCTGTGTATTCTTTTTCATATTGTTATTACATATATTATAATAATTTTCCTTATATAAATCGAATTTATTTTTTTG TTCATGTATAATATCATAATTATTTTGTTGTAGTATACAAAAATAATAATAGAAGAAAAAATGCGTATGAAAAAGGAGTA GATTTTTTATATTTTCTTTAGAGCTATTATTCATCTTGCTTTGATATTCATCTTGACATAATATGTATATAAAATTTAAG TTGTTTAATTTATCTATTGATATGTTTAACATTTGTATAAAACTATAATAATCTGTGTTATGTTGAATTATTGAAGAGAA TTTCGAAATGTCTTTTATTTCTTTTATATCTTTTATTTCTAAATATTTTAATATATTAAAAGTGCATTTATGATATAAAT CAAATAAAATTTGTATATGAACAATATTTTTCATATTTAAATTTAATATATATAATAACAATTTTGATAAGAATATTTTG TTATTAAAATATCTGTTAGGATCTATATATTTAACTATTAAAAGATAAAAGAAATTATGTTCATTTATTAGAATTGAAAA TAATTCTAATAAATTAATAAAATCATCAATATAATGAACATTTTCATGAATTAAATAAGTACAAAATAATTTAATAAGTC CATTTATTTCTTCATTAAATTCTTTTTTAAATTTTAGTAAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200599: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12005992320841AA5505891754m3gmbPfHB3.1, G. Roman Reddy


Date: 18:44:21 on Thu 23 Nov 117.