EST 1200603 is a singleton


Sequence

>1200603 (1 EST) Length=688 TGTTCAATTTTTTTATTTATGTTAATATGGGGATAGGAATATTTCCATTCACCGTTTACAAATCCCTTTGCTGAAATGTT ATGTCTTATTTTTGTTTGATTAAGATATATATCTCCGATTAATTTACCTCTAAAAGGTCTCATACTATATTTAATATATT TAAGGTAAAAATAGGTATTGTTTTTAACATCTTTGTCTACAATATAATGAAAATCATTTATTTTAATGACCTTTTTATTT TCATCATATTGATTTATTATATCATTGTGATTATTCACATTATTGTTAGTATATCCTTCGATAGCATGTTCTTTTACATC ATCATTTCCTTCGATCGTATTTTCTTTTACATCATCGTTTTCTTCCATATTATTATCTTCACCCCTATTTGCATCCTTTT TATTTTTTTTTAAAAAAAATTTATGACTGTTCAGGTAAATTGGATTCCAAAAAAGGCAGTTAATACCATTAAATGGTAAA GTGTGACATGTTTCAAATAAATTTTTTCTACTGGGATCTTTATTTGTAAATTCAGAAAAAAATTTTAAATTTAATTGTTC TATATCTACCCATCTTTTCTGATGTGTGTGCCAAGGATACTTGTCAACACATGGCCAAAACGCTTGTCTAGTTCTTGAAT CTCTTGCTCTATACGGAGATTTGTACATACGAAAATATGGGTACATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200603: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006032320845AA5505931758m3gmbPfHB3.1, G. Roman Reddy


Date: 19:36:11 on Mon 20 Nov 117.